zgc:112254

Ensembl ID:
ENSDARG00000057321
ZFIN ID:
ZDB-GENE-050706-68
Description:
U6 snRNA-specific terminal uridylyltransferase 1 [Source:RefSeq peptide;Acc:NP_001025359]
Human Orthologue:
TUT1
Human Description:
terminal uridylyl transferase 1, U6 snRNA-specific [Source:HGNC Symbol;Acc:26184]
Mouse Orthologue:
Tut1
Mouse Description:
terminal uridylyl transferase 1, U6 snRNA-specific Gene [Source:MGI Symbol;Acc:MGI:1917294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1424 Nonsense Available for shipment Available now
sa30664 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079945 Nonsense 88 797 2 10
Genomic Location (Zv9):
Chromosome 12 (position 11429174)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10312245
GRCz11 12 10350088
KASP Assay ID:
554-1345.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGTATTTCCAACAGTTTGGACTGGTGACGGATGTGATCATGGACAAA[C/T]AGAAGGTTAATACACACACTGCCTTTACCATCTGTTTTTGTTAATTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079945 Essential Splice Site 314 797 6 10
Genomic Location (Zv9):
Chromosome 12 (position 11423494)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10306565
GRCz11 12 10344408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTCACAAGGAGCTCAACCTCCAAGGAGACATCACCATCAACAACAG[G/A]TGATTTCTGACTGTGAAGTGAAAAACTCCACTAAATTGTAGTAGACTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link