
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:112254
- Ensembl ID:
- ENSDARG00000057321
- ZFIN ID:
- ZDB-GENE-050706-68
- Description:
- U6 snRNA-specific terminal uridylyltransferase 1 [Source:RefSeq peptide;Acc:NP_001025359]
- Human Orthologue:
- TUT1
- Human Description:
- terminal uridylyl transferase 1, U6 snRNA-specific [Source:HGNC Symbol;Acc:26184]
- Mouse Orthologue:
- Tut1
- Mouse Description:
- terminal uridylyl transferase 1, U6 snRNA-specific Gene [Source:MGI Symbol;Acc:MGI:1917294]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa1424 | Nonsense | Available for shipment | Available now |
sa30664 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa1424
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079945 | Nonsense | 88 | 797 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11429174)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10312245 GRCz11 12 10350088 - KASP Assay ID:
- 554-1345.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGAGTATTTCCAACAGTTTGGACTGGTGACGGATGTGATCATGGACAAA[C/T]AGAAGGTTAATACACACACTGCCTTTACCATCTGTTTTTGTTAATTTTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30664
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079945 | Essential Splice Site | 314 | 797 | 6 | 10 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11423494)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10306565 GRCz11 12 10344408 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAGTCACAAGGAGCTCAACCTCCAAGGAGACATCACCATCAACAACAG[G/A]TGATTTCTGACTGTGAAGTGAAAAACTCCACTAAATTGTAGTAGACTTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: