cbln1

Ensembl ID:
ENSDARG00000057296
ZFIN ID:
ZDB-GENE-040718-226
Description:
cerebellin 1 precursor [Source:RefSeq peptide;Acc:NP_001002520]
Human Orthologue:
CBLN1
Human Description:
cerebellin 1 precursor [Source:HGNC Symbol;Acc:1543]
Mouse Orthologue:
Cbln1
Mouse Description:
cerebellin 1 precursor protein Gene [Source:MGI Symbol;Acc:MGI:88281]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13627 Nonsense Available for shipment Available now
sa10043 Nonsense Available for shipment Available now
sa45635 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13627
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079926 Nonsense 76 158 1 4
ENSDART00000145342 Nonsense 77 190 1 3
Genomic Location (Zv9):
Chromosome 18 (position 17763906)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18115672
GRCz11 18 18104738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTTCCGTGGTGAGAAACACGAACCACGAGCCGTCGGAGATGAGCAAT[C/T]GAACTATGGTGATCTACTTCGATCAGGTACAGTTTCAGTATGGAAAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079926   None 158 None 4
ENSDART00000145342 Nonsense 179 190 3 3
Genomic Location (Zv9):
Chromosome 18 (position 17768297)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18120063
GRCz11 18 18109129
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCGCCTACCTCAAGCTGGAGCGAGGCAACCTGATGGGCGGCTGGAAATA[T/G]TCCACCTTCTCCGGCTTCCTGGTCTTCCCCCTGTAGAGGAGGGGTGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079926 Nonsense 149 158 4 4
ENSDART00000145342   None 190 3 3
Genomic Location (Zv9):
Chromosome 18 (position 17768796)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18120562
GRCz11 18 18109628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGTCCAGTCGCCCCTTCTTTCTCTGGCTCACCCTTTCTTGTTTCTG[T/A]GAGGGCGTCTGTTCTCTGAAGGATCTCTGAATCCCCACGAAAAGACTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link