slc25a16

Ensembl ID:
ENSDARG00000057287
ZFIN ID:
ZDB-GENE-030131-3299
Description:
solute carrier family 25, member 16 [Source:RefSeq peptide;Acc:NP_991112]
Human Orthologue:
SLC25A16
Human Description:
solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 [Source:HGNC
Mouse Orthologue:
Slc25a16
Mouse Description:
solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16 Gene [Source

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42171 Nonsense Mutation detected in F1 DNA During 2018
sa22264 Essential Splice Site Available for shipment Available now
sa28091 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079902 Nonsense 95 321 4 10
Genomic Location (Zv9):
Chromosome 13 (position 18241413)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18061448
GRCz11 13 18192440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGACTCTATAAAGGAAATGGAGCTATGATGATCAGGATTTTCCCATA[T/A]GGGGCCATACAGTTCATGGCTTTTGATAACTACAAAAAGGTGCCTTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079902 Essential Splice Site 108 321 4 10
Genomic Location (Zv9):
Chromosome 13 (position 18241373)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18061408
GRCz11 13 18192400
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCCATATGGGGCCATACAGTTCATGGCTTTTGATAACTACAAAAAG[G/A]TGCCTTTAGTCATCATTTACTTACTCTTTTTTGGGAATAAGAAACTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079902 Essential Splice Site 170 321 6 10
Genomic Location (Zv9):
Chromosome 13 (position 18235016)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18055051
GRCz11 13 18186043
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATCGGTACACCGGCATAAGACATGCCTTTCAGACAATTTACCATAAG[G/A]TATTAGGGATACAAACGAGTATAATTAAGAAAAAATCTGAGAATTCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link