si:dkey-91i10.3

Ensembl ID:
ENSDARG00000057262
ZFIN ID:
ZDB-GENE-081105-124
Description:
sterol 26-hydroxylase, mitochondrial [Source:RefSeq peptide;Acc:NP_001116749]
Human Orthologue:
CYP27A1
Human Description:
cytochrome P450, family 27, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2605]
Mouse Orthologue:
Cyp27a1
Mouse Description:
cytochrome P450, family 27, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88594]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21477 Nonsense Available for shipment Available now
sa34631 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21478 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079879 Nonsense 474 513 8 9
Genomic Location (Zv9):
Chromosome 9 (position 24052163)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23207949
GRCz11 9 23018818
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGCTTGTCTGGGCCGCAGAGTGGCTGAACTGGAGATGTACCTTCTCT[T/A]GTCCCGGGTAAACAACACTCATAACTGTCATAGTTTCATAGTTTCAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079879 Essential Splice Site 476 513 8 9
Genomic Location (Zv9):
Chromosome 9 (position 24052171)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23207957
GRCz11 9 23018826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGGGCCGCAGAGTGGCTGAACTGGAGATGTACCTTCTCTTGTCCCGG[G/A]TAAACAACACTCATAACTGTCATAGTTTCATAGTTTCAATAGTTTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079879 Essential Splice Site 476 513 8 9
Genomic Location (Zv9):
Chromosome 9 (position 24052172)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 23207958
GRCz11 9 23018827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGGCCGCAGAGTGGCTGAACTGGAGATGTACCTTCTCTTGTCCCGGG[T/C]AAACAACACTCATAACTGTCATAGTTTCATAGTTTCAATAGTTTCATAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link