zmynd11

Ensembl ID:
ENSDARG00000057249
ZFIN ID:
ZDB-GENE-050522-301
Description:
zinc finger, MYND domain containing 11 isoform 2 [Source:RefSeq peptide;Acc:NP_001071051]
Human Orthologue:
ZMYND11
Human Description:
zinc finger, MYND domain containing 11 [Source:HGNC Symbol;Acc:16966]
Mouse Orthologue:
Zmynd11
Mouse Description:
zinc finger, MYND domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1913755]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44159 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6776 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105768 Essential Splice Site 222 640 8 17

The following transcripts of ENSDARG00000057249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28109327)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27159914
GRCz11 24 27239073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACAAAAGACTGATCCACACGCCTCTGGATGTGGAAAACATACAAGAG[G/A]TAAAAACGAATTAAAAAATAAAGATCTCCCAGCGGTTTTGGCATGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105768 Nonsense 407 640 13 17

The following transcripts of ENSDARG00000057249 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 28106819)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 27157406
GRCz11 24 27236565
KASP Assay ID:
554-5020.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGACAGGTCAGAGAGGCACGAAAGGCAGGAAGAACGACAGGAAGAAGCY[G/T]AGTCAAGCATCTCGTCCACATCCAATGAGCAGGTGAGCACTTTTCTGYTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link