si:dkey-30k6.5

Ensembl ID:
ENSDARG00000057238
ZFIN ID:
ZDB-GENE-091204-299

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23908 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079850 Essential Splice Site 423 515 3 3
ENSDART00000144366   647 757 4 4
Genomic Location (Zv9):
Chromosome 21 (position 19223219)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20358708
GRCz11 21 20395344
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACATACAGGAGAGAAGCATCATGAAAGACTGATCAGTCCTCTGCTGAA[G/A]AAGTTTGCTTGCGATCATTGTCAAAAGAAGTTCTACTCACAAGCCGCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link