zgc:55292

Ensembl ID:
ENSDARG00000057234
ZFIN ID:
ZDB-GENE-030131-210
Description:
hypothetical protein LOC321491 [Source:RefSeq peptide;Acc:NP_955840]
Human Orthologue:
C1orf77
Human Description:
chromosome 1 open reading frame 77 [Source:HGNC Symbol;Acc:24511]
Mouse Orthologue:
2500003M10Rik
Mouse Description:
RIKEN cDNA 2500003M10 gene Gene [Source:MGI Symbol;Acc:MGI:1913761]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6123 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079842 Essential Splice Site 72 231 None 6
ENSDART00000126079 Essential Splice Site 72 241 None 7
ENSDART00000139856 Essential Splice Site 47 206 None 4

The following transcripts of ENSDARG00000057234 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 24400028)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 24330140
GRCz11 19 23914363
KASP Assay ID:
554-3822.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATGGAGAACAGGCCCTCTGWGCAGGCTGCACTTCATCACAAACAGG[T/C]AAGAGGACAAAAAGTGCAAACCACMGGAAATGGTAGAGATGTCAATGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link