Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:55292
- Ensembl ID:
- ENSDARG00000057234
- ZFIN ID:
- ZDB-GENE-030131-210
- Description:
- hypothetical protein LOC321491 [Source:RefSeq peptide;Acc:NP_955840]
- Human Orthologue:
- C1orf77
- Human Description:
- chromosome 1 open reading frame 77 [Source:HGNC Symbol;Acc:24511]
- Mouse Orthologue:
- 2500003M10Rik
- Mouse Description:
- RIKEN cDNA 2500003M10 gene Gene [Source:MGI Symbol;Acc:MGI:1913761]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa6123 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6123
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000079842 | Essential Splice Site | 72 | 231 | None | 6 |
| ENSDART00000126079 | Essential Splice Site | 72 | 241 | None | 7 |
| ENSDART00000139856 | Essential Splice Site | 47 | 206 | None | 4 |
The following transcripts of ENSDARG00000057234 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 24400028)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 24330140 GRCz11 19 23914363 - KASP Assay ID:
- 554-3822.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAGATGGAGAACAGGCCCTCTGWGCAGGCTGCACTTCATCACAAACAGG[T/C]AAGAGGACAAAAAGTGCAAACCACMGGAAATGGTAGAGATGTCAATGTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
