zgc:174164

Ensembl ID:
ENSDARG00000057138
ZFIN ID:
ZDB-GENE-030131-4971
Description:
disintegrin and metalloproteinase domain-containing protein 9 [Source:RefSeq peptide;Acc:NP_0011079
Human Orthologue:
ADAM9
Human Description:
ADAM metallopeptidase domain 9 [Source:HGNC Symbol;Acc:216]
Mouse Orthologue:
Adam9
Mouse Description:
a disintegrin and metallopeptidase domain 9 (meltrin gamma) Gene [Source:MGI Symbol;Acc:MGI:105376]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22047 Nonsense Available for shipment Available now
sa41977 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10768 Nonsense Available for shipment Available now
sa6238 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1943 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079645 Nonsense 18 801 1 22
Genomic Location (Zv9):
Chromosome 12 (position 12455840)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11311493
GRCz11 12 11349796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCGGCACGTTAACATCTTCGTCCTTATTCTCATAAACTTCTCAATTTG[T/A]CCAGGTAAGACATATCAATTCATTTATCCTTAATATTTTCAAACTGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079645 Essential Splice Site 424 801 13 22
Genomic Location (Zv9):
Chromosome 12 (position 12436395)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11292048
GRCz11 12 11330351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTTTTCATTGCTGGTGTCCTAAATGAAGTGTTGCTGATGTGTTGCA[G/T]GAATGCAATACTACATGCTGTAATGCTGCCACATGCACCTTCACTAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079645 Nonsense 650 801 18 22
Genomic Location (Zv9):
Chromosome 12 (position 12430531)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11286184
GRCz11 12 11324487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCWTTTGTAAKGCTGTGTGGCGTTCTCACAGGTGTGTAATGATCGATA[T/A]CATTGTCATTGTAATAAWGGCTGGGGTCCACCCAACTGTAACAAAGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079645 Essential Splice Site 727 801 20 22
Genomic Location (Zv9):
Chromosome 12 (position 12425500)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11281153
GRCz11 12 11319456
KASP Assay ID:
554-4987.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTAGTTTAAAATCTTCTGATATTAATATTTTGCTTAATGTTTTACAAC[A/G]GGCCAACGAATGCAGCAAATGGTTCTTCGAACACACCGTCAAATGTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079645 Essential Splice Site 767 801 20 22
Genomic Location (Zv9):
Chromosome 12 (position 12425376)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11281029
GRCz11 12 11319332
KASP Assay ID:
554-1931.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCGCTCCACAGTCGATGACAGAAATTCAAACAGCACACCAATCACAGG[T/C]TACCACACTGCCACACAATGAATTATTACTCGAAAAGAAACAGGGCTACA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link