si:dkey-246j23.5

Ensembl ID:
ENSDARG00000057121
ZFIN IDs:
ZDB-GENE-021120-1, ZDB-GENE-021120-1, ZDB-GENE-091111-2
Description:
LOC570832 protein [Source:UniProtKB/TrEMBL;Acc:Q498V9]
Human Orthologue:
C7
Human Description:
complement component 7 [Source:HGNC Symbol;Acc:1346]
Mouse Orthologue:
C7
Mouse Description:
complement component 7 Gene [Source:MGI Symbol;Acc:MGI:88235]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43624 Nonsense Mutation detected in F1 DNA During 2018
sa39327 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43625 Nonsense Mutation detected in F1 DNA During 2018
sa23912 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079718 Nonsense 219 833 7 18
ENSDART00000132741 Nonsense 220 834 7 18
Genomic Location (Zv9):
Chromosome 21 (position 19734784)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20870273
GRCz11 21 20906909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGATGACTACTATGACAGTTCCTGGTCCTACATGAGGGATGAAAAG[C/T]AAAGAAGGATCATTCGGGGAGGCCATGATCATAAAACCTTTCATAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079718 Essential Splice Site 241 833 8 18
ENSDART00000132741 Essential Splice Site 242 834 8 18
Genomic Location (Zv9):
Chromosome 21 (position 19734931)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20870420
GRCz11 21 20907056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGACTTGTTATAATGATATATTTAAAGAGTGTTTTTCTGTTTTTAAA[G/A]ACCTATCACCTGCTGATAATAAGAAATGAGGTAGAAGTGGCTCAGTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079718 Nonsense 281 833 8 18
ENSDART00000132741 Nonsense 282 834 8 18
Genomic Location (Zv9):
Chromosome 21 (position 19735054)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20870543
GRCz11 21 20907179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGTCTGAAGATTTTTGGAAGGATCTATCAGCTCTGCCCATCACATA[T/A]GAGCCATCAGCCTATCGACTATTCATACAGCGATATGGTACTCACTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079718 Nonsense 447 833 11 18
ENSDART00000132741 Nonsense 448 834 11 18
Genomic Location (Zv9):
Chromosome 21 (position 19737831)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20873320
GRCz11 21 20909956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTAAAGAAAGTCCACCTGAAGAGGGCACTGGAGGCCTATCTGGAGGAG[C/T]AGAGCCCCTGTCACTGCAGACCCTGTCAGAACAATGGCATGGCTGTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link