zgc:101819

Ensembl ID:
ENSDARG00000057114
ZFIN ID:
ZDB-GENE-030131-740
Description:
UPF0609 protein C4orf27 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7SXS8]
Human Orthologue:
C4orf27
Human Description:
chromosome 4 open reading frame 27 [Source:HGNC Symbol;Acc:26051]
Mouse Orthologue:
2700029M09Rik
Mouse Description:
RIKEN cDNA 2700029M09 gene Gene [Source:MGI Symbol;Acc:MGI:1919862]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45067 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079716 Nonsense 111 348 3 8
Genomic Location (Zv9):
Chromosome 1 (position 12907018)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 13335760
GRCz11 1 14022273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACTCATCTTCTCAGCCCAACTTTCACCTTCATTGGCGTTATTTCTA[T/A]GATCCCCCAGAATTCCAGACCATCATACAGGGCAATGCAGACACCCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link