zwilch

Ensembl ID:
ENSDARG00000057100
ZFIN ID:
ZDB-GENE-050420-101
Description:
Protein zwilch homolog [Source:UniProtKB/Swiss-Prot;Acc:A5WWB6]
Human Orthologue:
ZWILCH
Human Description:
Zwilch, kinetochore associated, homolog (Drosophila) [Source:HGNC Symbol;Acc:25468]
Mouse Orthologue:
Zwilch
Mouse Description:
Zwilch, kinetochore associated, homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1915264]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36630 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43087 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36631 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43088 Nonsense Mutation detected in F1 DNA During 2018
sa538 Essential Splice Site Confirmed mutation in F2 line During 2018

Mutation Details

Allele Name:
sa36630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079695 Essential Splice Site 30 583 None 19
ENSDART00000079695 Essential Splice Site 30 583 None 19

The following transcripts of ENSDARG00000057100 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 19237630)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19467853
GRCz11 18 19456919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTAGGTTATGCCAAGATGAAAGTAAAGACAACTGCACGTATATGG[T/G]AAAACGCATGTGATATAAACGAATAGACAAATTGGTGTTGAAAAGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079695 Essential Splice Site 30 583 None 19
ENSDART00000079695 Essential Splice Site 30 583 None 19

The following transcripts of ENSDARG00000057100 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 19237630)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19467853
GRCz11 18 19456919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTTTAGGTTATGCCAAGATGAAAGTAAAGACAACTGCACGTATATGG[T/G]AAAACGCATGTGATATAAACGAATAGACAAATTGGTGTTGAAAAGTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079695 Essential Splice Site 62 583 4 19

The following transcripts of ENSDARG00000057100 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 19238298)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19468521
GRCz11 18 19457587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAGGAAATTGAATGAATGACTAAATATTTGTTTGTTATTCATAATAA[G/T]CAAACCAAGTATGAACCCGAAGCTACAGAAACGTCAGCAGACACCAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079695 Nonsense 341 583 11 19

The following transcripts of ENSDARG00000057100 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 19244278)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19474501
GRCz11 18 19463567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCTTTAGTTCAATGGTAATTGAGAGAGGAGACCTTGACTTTACAGAA[C/T]AACTGTGGGAGAAGATGAGAAAGAGTAAAAGAGCTTTTTTATTATTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa538
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079695 Essential Splice Site 438 583 15 19

The following transcripts of ENSDARG00000057100 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 19247135)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19477358
GRCz11 18 19466424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTATGCGCTAATTTTTTTTAAAAATGTGTTTTTTTTTTCTAAACTTTC[A/G]GAGTTACTACTTAGACACTGAGGTGGATCTGCAGGAGCAGGTGGTTAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link