wu:fc13c02

Ensembl ID:
ENSDARG00000057062
ZFIN IDs:
ZDB-GENE-030131-2610, ZDB-GENE-090313-189

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6739 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079661 Nonsense 437 683 1 2
ENSDART00000134418 Nonsense 440 684 5 5
ENSDART00000141305   None 128 None 3

The following transcripts of ENSDARG00000057062 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 27376315)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27209137
GRCz11 23 27135678
KASP Assay ID:
554-5374.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTWTGCTTTGGACTGAAYTGGCTGGGAACTGTCACATTAAAGCAGCAT[T/G]AGARGAGGACCTGCTGTGGCCTGTCCTGCGACCCAACCCTGCAATCCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link