zgc:110200

Ensembl ID:
ENSDARG00000057035
ZFIN ID:
ZDB-GENE-050417-366
Description:
hypothetical protein LOC550523 [Source:RefSeq peptide;Acc:NP_001017825]
Human Orthologue:
STOML3
Human Description:
stomatin (EPB72)-like 3 [Source:HGNC Symbol;Acc:19420]
Mouse Orthologue:
Stoml3
Mouse Description:
stomatin (Epb7.2)-like 3 Gene [Source:MGI Symbol;Acc:MGI:2388072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10092 Essential Splice Site Available for shipment Available now
sa30938 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079628 Essential Splice Site 171 278 None 7
ENSDART00000081834 Essential Splice Site 108 215 None 7
ENSDART00000132830 Essential Splice Site 173 280 None 7
Genomic Location (Zv9):
Chromosome 10 (position 25073304)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24672656
GRCz11 10 24642108
KASP Assay ID:
2260-3246.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTGCTGAGGTCCTWTCTGACAGAGAAGGCATCTCCCATAGTATGCAGG[T/C]GAKTGTGGAAAATGAAATAATGKTCTCCTSAGTTGTGYATGCATGATCYW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079628 Nonsense 191 278 6 7
ENSDART00000081834 Nonsense 128 215 6 7
ENSDART00000132830 Nonsense 193 280 6 7
Genomic Location (Zv9):
Chromosome 10 (position 25073137)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24672489
GRCz11 10 24641941
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGATGAGGCCACAGATTCATGGGGCATCAAGGTGGAGCGAGTGGAGATT[A/T]AAGATGTTAAACTGCCACAGCAGCTGCAGAGAGCAATGGCAGCTGAGGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link