zgc:171765

Ensembl ID:
ENSDARG00000057032
ZFIN ID:
ZDB-GENE-071004-34
Description:
phosphatase 1A-like [Source:RefSeq peptide;Acc:NP_001096587]
Human Orthologue:
PPM1N
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative) [Source:HGNC Symbol;Acc:26845]
Mouse Orthologue:
Ppm1n
Mouse Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative) Gene [Source:MGI Symbol;Acc:MGI:2142330]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43630 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079629 Nonsense 348 435 3 6
Genomic Location (Zv9):
Chromosome 21 (position 20198496)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21333985
GRCz11 21 21370621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATAACATCAGCATCATTCTAGTGTGTTTCCCTGGCGCCCCCCAGCTGT[C/A]ACCTGAAGCACTGCACCATGAGGCTGAGCTTGAGGACTTTTTGGAGTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link