vps36

Ensembl ID:
ENSDARG00000057021
ZFIN ID:
ZDB-GENE-030131-7753
Description:
Vacuolar protein-sorting-associated protein 36 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVK4]
Human Orthologue:
VPS36
Human Description:
vacuolar protein sorting 36 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:20312]
Mouse Orthologue:
Vps36
Mouse Description:
vacuolar protein sorting 36 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1917410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41659 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41659
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079597 Essential Splice Site 280 382 10 14
ENSDART00000139641   None 161 None 6
ENSDART00000142617   None 147 None 6

The following transcripts of ENSDARG00000057021 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 25100042)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24699394
GRCz11 10 24668846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCCTGACTGAAGTTTACTGTCTGGTGAACAGAGCCCGAGGGATGGAG[G/A]TTAGATGAAACTCCGTACACTCAGCAGCATCAGTGCATCTTATCATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link