slc6a4b

Ensembl ID:
ENSDARG00000057017
ZFIN ID:
ZDB-GENE-060314-2
Description:
solute carrier family 6 (neurotransmitter transporter, serotonin), member 4B [Source:RefSeq peptide
Human Orthologue:
SLC6A4
Human Description:
solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Slc6a4
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 Gene [Source:MGI Symbol;

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40389 Nonsense Mutation detected in F1 DNA During 2018
sa33568 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20377 Nonsense Available for shipment Available now
sa15666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40389
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086881 Nonsense 254 591 5 13
Genomic Location (Zv9):
Chromosome 5 (position 21764222)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19477094
GRCz11 5 19980894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGGTAGTATGGGTTACTGCCACCCTGCCATATGTTGTGCTGCTGATTT[T/A]GATGATCAGAGGTGCCACTTTGCCCGGAGCTTGGAAAGGAGTGGTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086881 Essential Splice Site 284 591 6 13
Genomic Location (Zv9):
Chromosome 5 (position 21761856)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19474728
GRCz11 5 19978528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAGCGCTATGAATACTTTCCGGATGCACTGTATATACTGTTTTGC[A/T]GGTATGGGTAGATGCAGCTGCGCAGATCTTCTTTTCTCTTGGTCCTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086881 Nonsense 309 591 6 13
Genomic Location (Zv9):
Chromosome 5 (position 21761777)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19474649
GRCz11 5 19978449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTCTCTTGGTCCTGGTTTTGGGGTCCTGCTTGCCCTGTCCAGCTA[C/A]AATCCCTTCACTAATAACTGTTACAGGTACACAATGAGCACTTTCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086881 Nonsense 527 591 12 13
Genomic Location (Zv9):
Chromosome 5 (position 21753476)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19466348
GRCz11 5 19970148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATTATCAGCTCACTGTTGAACCCTCAAACCCTGACGCTATTCGACTA[C/A]GAGTTCCCCGACTGGAGYATCACGGTCGGCTACATCATCGGAGCTTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link