
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ctbp1
- Ensembl ID:
- ENSDARG00000057007
- ZFIN ID:
- ZDB-GENE-010130-1
- Description:
- C-terminal binding protein 1 [Source:RefSeq peptide;Acc:NP_571789]
- Human Orthologue:
- CTBP1
- Human Description:
- C-terminal binding protein 1 [Source:HGNC Symbol;Acc:2494]
- Mouse Orthologue:
- Ctbp1
- Mouse Description:
- C-terminal binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201685]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19082 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa197 | Nonsense | Available for shipment | Available now |
sa35683 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa19082
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079583 | Essential Splice Site | None | 449 | 2 | 11 |
ENSDART00000122739 | None | 449 | None | 9 | |
ENSDART00000144367 | None | 288 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 14 (position 22824514)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 21524002 GRCz11 14 21821247 - KASP Assay ID:
- 2261-7170.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAAGACTGTGACGTCAGCAGAGTGGTTGATTGGCTTTGACATCATCAAG[T/C]AGGTGGTTGCATTATTATTATTATTATTATTATTATTTTCAGTCATCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa197
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079583 | Nonsense | 60 | 449 | 4 | 11 |
ENSDART00000122739 | Nonsense | 60 | 449 | 2 | 9 |
ENSDART00000144367 | Nonsense | 44 | 288 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 14 (position 22837679)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 21537167 GRCz11 14 21834412 - KASP Assay ID:
- 554-0109.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTACAGTGGAGATGCCCATCCTGAAGGACGTGGCCACTGTGGCTTTCTG[C/A]GATGCCCAGTCCACCCAGGAGATCCATGAGAAGGTATCGTCATAAGGATT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Mutation Details
- Allele Name:
- sa35683
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079583 | Nonsense | 179 | 449 | 6 | 11 |
ENSDART00000122739 | Nonsense | 179 | 449 | 4 | 9 |
ENSDART00000144367 | Nonsense | 163 | 288 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 14 (position 22838192)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 21537680 GRCz11 14 21834925 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCCAGCGTGGAGCAGATCCGGGAAGTAGCCGGAGGCGCAGCACGTATT[C/T]GAGGAGAAACGCTGGGCATCATTGGGCTGGGTGAGTCCTGATGTGATTTA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: