tpte

Ensembl ID:
ENSDARG00000056985
ZFIN ID:
ZDB-GENE-030131-5503
Description:
transmembrane phosphatase with tensin homology [Source:RefSeq peptide;Acc:NP_001020629]
Human Orthologues:
TPTE, TPTE2
Human Descriptions:
transmembrane phosphatase with tensin homology [Source:HGNC Symbol;Acc:12023]
transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 [Source:HGNC Symbol;Acc:17299]
Mouse Orthologue:
Tpte
Mouse Description:
transmembrane phosphatase with tensin homology Gene [Source:MGI Symbol;Acc:MGI:2446460]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41660 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079549 Essential Splice Site 327 511 14 20

The following transcripts of ENSDARG00000056985 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 25131380)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24730732
GRCz11 10 24700184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGTTTGCACATGGCTCATTGACAGCGATCAGTTTGAGAGTGCACAGG[T/C]ACAGGCTGATCATATTATCCATATTTCAGATTCCTTCTCTTCCTCAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link