si:dkeyp-38g8.5

Ensembl ID:
ENSDARG00000056954
ZFIN ID:
ZDB-GENE-081104-62
Description:
hypothetical protein LOC568385 [Source:RefSeq peptide;Acc:NP_001116762]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14997 Nonsense Available for shipment Available now
sa20246 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050407 Nonsense 222 342 4 4
Genomic Location (Zv9):
Chromosome 4 (position 15387487)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16330327
GRCz11 4 16319303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTAGAAAGCGATAAAGCAGCTATTGAATATGAAAGGATGGTGCTARAG[C/T]GAGAGAAGATGGTGCTAGACAGAGAAYGAGCGGGAGTGGAAAGAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050407 Nonsense 292 342 4 4
Genomic Location (Zv9):
Chromosome 4 (position 15387697)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16330537
GRCz11 4 16319513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTGACAGAGAAAGGGCTAAGCTTGAAAGAGAACGGGCCATCCTGGAT[C/T]AACAGCGTGGGATTGAAAAAAGCGAGCAGACGGTTAATTTAAACGACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link