
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
sap130a
- Ensembl ID:
- ENSDARG00000056924
- ZFIN ID:
- ZDB-GENE-070615-5
- Description:
- histone deacetylase complex subunit SAP130 [Source:RefSeq peptide;Acc:NP_001092247]
- Human Orthologue:
- SAP130
- Human Description:
- Sin3A-associated protein, 130kDa [Source:HGNC Symbol;Acc:29813]
- Mouse Orthologue:
- Sap130
- Mouse Description:
- Sin3A associated protein Gene [Source:MGI Symbol;Acc:MGI:1919782]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33876 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa33877 | Nonsense | Available for shipment | Available now |
sa9968 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa33876
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079457 | None | 639 | None | 11 | |
ENSDART00000088903 | Nonsense | 200 | 333 | 5 | 8 |
ENSDART00000123324 | Nonsense | 199 | 1072 | 5 | 21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 27733331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 28034542 GRCz11 6 28025103 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGTGCTTCTTGTAGAAACGGTTTTGACAGGAATAATGTTTCTCCAGGGA[C/T]AGAGTAACCTGCATCAGCTAATGGCAACTAATGTGCAGATCTTCAGGGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33877
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079457 | None | 639 | None | 11 | |
ENSDART00000088903 | None | 333 | None | 8 | |
ENSDART00000123324 | Nonsense | 301 | 1072 | 7 | 21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 27739649)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 28040860 GRCz11 6 28031421 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACATCAACTGCTGTTCTACCCACAATGGTGGCGCCAATCCCAGCTGCT[C/T]GAACCCAGTCCCCGGTCATCAACACCACTGTCACACACGCTACAGAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9968
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079457 | Nonsense | 430 | 639 | 7 | 11 |
ENSDART00000088903 | None | 333 | None | 8 | |
ENSDART00000123324 | Nonsense | 863 | 1072 | 17 | 21 |
- Genomic Location (Zv9):
- Chromosome 6 (position 27749360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 28050571 GRCz11 6 28041132 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACCTGGAGAGCTTCWGCCTGGTGCCTCTCCAAGGAAGAAACCYCGGAAA[C/T]AGCAGCATGTGATCTCCACTGAGGAGACKGAGATGGTGGAGACTAACAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: