zgc:136360

Ensembl ID:
ENSDARG00000056914
ZFIN ID:
ZDB-GENE-060421-2909
Description:
probable ribosome biogenesis protein NEP1 [Source:RefSeq peptide;Acc:NP_001035427]
Human Orthologue:
EMG1
Human Description:
EMG1 nucleolar protein homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:16912]
Mouse Orthologue:
Emg1
Mouse Description:
EMG1 nucleolar protein homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1315195]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6420 Essential Splice Site Mutation detected in F1 DNA During 2018
sa685 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079497 Essential Splice Site 50 238 1 5
Genomic Location (Zv9):
Chromosome 16 (position 19319594)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17349917
GRCz11 16 17257894
KASP Assay ID:
554-4787.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGCGTCTTGTCGTTGTTTTAGAAGGAGCGACGCTTGAAACCGTAAAG[G/A]TAAAAGACAAAGTGGCTCCGTAGATTTGAAACCCCTTTTTTGGATGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa685
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079497 Essential Splice Site 84 238 2 5
Genomic Location (Zv9):
Chromosome 16 (position 19319361)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17349684
GRCz11 16 17257661
KASP Assay ID:
554-0593.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGTGGCAGAGACCCAGGGAAGATTCGTCCTGATATCACACATCAGG[T/C]AAAACACATTAACCCTCATAATGCATGCGATTCGTTTTTACACGGATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link