si:dkeyp-87a6.1

Ensembl ID:
ENSDARG00000056888
ZFIN ID:
ZDB-GENE-091204-287
Human Orthologue:
DNAH8
Human Description:
dynein, axonemal, heavy chain 8 [Source:HGNC Symbol;Acc:2952]
Mouse Orthologue:
Dnahc8
Mouse Description:
dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30123 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32492 Nonsense Available for shipment Available now
sa13336 Essential Splice Site Available for shipment Available now
sa11639 Essential Splice Site Available for shipment Available now
sa9089 Nonsense Mutation detected in F1 DNA During 2018
sa12494 Nonsense Available for shipment Available now
sa16014 Nonsense Available for shipment Available now
sa24530 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Essential Splice Site 660 4667 15 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34858902)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33710351
GRCz11 24 33596526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTCTGTTGATGCACTGATTGACACATGGCTTCAACGACCACTCACTG[T/C]AAGGGCATTTTGCAAATATACCATTAGTGAGCTGACACTTGAAAGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32492
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Nonsense 1455 4667 31 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34878119)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33729568
GRCz11 24 33615743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGATCTTCACAGAATCAAACGAGAGCTCAACCTCCTCTCCAAGCTCTA[C/A]AGTCTTTACAATTCTGTCATTGACAGCGTTTCAGGCTACTATGACATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13336
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Essential Splice Site 1491 4667 31 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34878228)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33729677
GRCz11 24 33615852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTCAATATAGAGAAGATCAACAATGAGCTGCTGGATTTCCAGAACAGG[T/G]TTCTTATGATAGTCWCATACTTAAAGGTCTCGTGAATCAATTTAAAATGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Essential Splice Site 2295 4667 46 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34894063)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33745512
GRCz11 24 33631687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATTCTYAAACTTGTGCARCTRTATGAGACTCAGAGAGTGAGACACG[G/A]TTAGTCATTCATTATTCATYTGWCAAATATATGTCACATGCTCAGAYTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9089
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Nonsense 2990 4667 56 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34921743)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33773192
GRCz11 24 33659367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAATATCCCGTATAATCCGGACGGCTCGTGGGAATGCWCTACTGGTT[G/T]GAGTCGGAGGTTCTGGGAAACAGAGTCTCACCAGACTTGCATCCTTYATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Nonsense 3861 4667 68 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34936043)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33787492
GRCz11 24 33673667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCTCGAGAGGAGTACCGTCCAGTGGCCAYCAGRGGGAGCATCCTGTA[T/A]TTYCTGATTGTGGAGWKGAGTCTGGTCAAWGTGMTGTACCAAACCTCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Nonsense 4199 4667 72 79
ENSDART00000142660   None 438 None 7
Genomic Location (Zv9):
Chromosome 24 (position 34945284)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33796733
GRCz11 24 33682908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATGTGTGATCTGTAATGCAGGGGTGAAGGCTGGACTCAAGCGGACATA[T/G]AATAGTGTGACKCAAGAGCARTTGGAGATCACAAACATGCCTCAGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24530
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079342 Nonsense 4359 4667 75 79
ENSDART00000142660 Nonsense 130 438 3 7
Genomic Location (Zv9):
Chromosome 24 (position 34947350)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33798799
GRCz11 24 33684974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGTTCAACAGGTATTTGGCCTCCATCCCAACGCTGACATCACTTAC[C/T]AGACCAATTTGGCTAATGATACCCTGAGTACCATCCTCAACATCCAGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link