vamp2

Ensembl ID:
ENSDARG00000056877
ZFIN ID:
ZDB-GENE-030131-8225
Description:
vesicle-associated membrane protein 2 [Source:RefSeq peptide;Acc:NP_956299]
Human Orthologue:
VAMP1
Human Description:
vesicle-associated membrane protein 1 (synaptobrevin 1) [Source:HGNC Symbol;Acc:12642]
Mouse Orthologue:
Vamp1
Mouse Description:
vesicle-associated membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1313276]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38797 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079454 Essential Splice Site 105 110 4 5
Genomic Location (Zv9):
Chromosome 10 (position 23041604)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22871942
GRCz11 10 22841394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGATTATCCTGGGGGTGATATGCGTGATTGTCCTCATTATAATCATTG[G/A]TAAGCAATGAACATTTCCATCATTTTTACATGAATGTTCTGAGATTAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hip geometry: Genome-wide association with bone mass and geometry in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link