zgc:91931

Ensembl ID:
ENSDARG00000056871
ZFIN ID:
ZDB-GENE-040718-421
Description:
AP-4 complex subunit mu-1 [Source:RefSeq peptide;Acc:NP_001002672]
Human Orthologue:
AP4M1
Human Description:
adaptor-related protein complex 4, mu 1 subunit [Source:HGNC Symbol;Acc:574]
Mouse Orthologue:
Ap4m1
Mouse Description:
adaptor-related protein complex AP-4, mu 1 Gene [Source:MGI Symbol;Acc:MGI:1337063]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41654 Essential Splice Site Mutation detected in F1 DNA During 2018
sa1209 Nonsense F2 line generated During 2018
sa41655 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21726 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079437 Essential Splice Site 20 442 1 15
Genomic Location (Zv9):
Chromosome 10 (position 23055309)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22885647
GRCz11 10 22855099
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTTTCATCTTGTCATCAAAAGGAGATCATCTCATATATAAAGACTG[T/A]ATCCTTCCCACGGGCTTGTGTGATGTGATGTGTTTATAACTGTCTGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1209
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079437 Nonsense 33 442 2 15
Genomic Location (Zv9):
Chromosome 10 (position 23055520)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22885858
GRCz11 10 22855310
KASP Assay ID:
554-1118.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATATCAGTCCGAGGAGAGGCCAGTAAAGACTCAATAAATGTCTTCTA[T/A]GAGATGGTCACAGCTCTCAGTGGAGATCAGCCTCCTGTTGTCATGGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079437 Essential Splice Site 84 442 3 15
Genomic Location (Zv9):
Chromosome 10 (position 23055767)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22886105
GRCz11 10 22855557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACCAAAACAAACCCTTCCCCTTTCACCATAATTGAGTTCCTTAACAG[G/A]TTAACAAATATAATTTTTGGATCAGTAATGTGATAATATGATTTTCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21726
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079437 Essential Splice Site 201 442 7 15
Genomic Location (Zv9):
Chromosome 10 (position 23058061)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22888399
GRCz11 10 22857851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATCTTTGTGGATGTGATAGAGAGGCTGTCTGTGGTTATTGGCTCCAAT[G/A]TAAGTAAAGCTCAATGAATCATGGCTTGACATTAAACTACTGATCATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link