si:dkey-27c15.3

Ensembl ID:
ENSDARG00000056847
ZFIN ID:
ZDB-GENE-060503-728
Human Orthologues:
GON4L, YY1AP1
Human Descriptions:
gon-4-like (C. elegans) [Source:HGNC Symbol;Acc:25973]
YY1 associated protein 1 [Source:HGNC Symbol;Acc:30935]
Mouse Orthologue:
Gon4l
Mouse Description:
gon-4-like (C.elegans) Gene [Source:MGI Symbol;Acc:MGI:1917579]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10568 Essential Splice Site Available for shipment Available now
sa23532 Essential Splice Site Available for shipment Available now
sa29218 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079410 Essential Splice Site 135 712 5 20
ENSDART00000138322 Essential Splice Site 129 1033 4 25
Genomic Location (Zv9):
Chromosome 19 (position 27174206)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27104318
GRCz11 19 26688541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTYCCACTTGGAATATTTYACCAATTAAGAAGCCAACAGAAGCAAAG[G/A]TGATCAGCAGAGTACATTTGCAAGAAAACATGCATGAGACTGGGAGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23532
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079410 Essential Splice Site 135 712 5 20
ENSDART00000138322 Essential Splice Site 129 1033 4 25
Genomic Location (Zv9):
Chromosome 19 (position 27174207)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27104319
GRCz11 19 26688542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCCCACTTGGAATATTTCACCAATTAAGAAGCCAACAGAAGCAAAGG[T/C]GATCAGCAGAGTACATTTGCAAGAAAACATGCATGAGACTGGGAGCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079410 Nonsense 676 712 20 20
ENSDART00000138322   None 1033 None 25
Genomic Location (Zv9):
Chromosome 19 (position 27188913)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27119025
GRCz11 19 26703248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATAAACACAACATACTGTTAAATAATTTCTCCTACATTTTTCAGACGTA[C/A]TTCATGGCAGGAAAATGCCCCTCCATGCCCTTGGCCAGTAAGAGGGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link