
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-27c15.3
- Ensembl ID:
- ENSDARG00000056847
- ZFIN ID:
- ZDB-GENE-060503-728
- Human Orthologues:
- GON4L, YY1AP1
- Human Descriptions:
- gon-4-like (C. elegans) [Source:HGNC Symbol;Acc:25973]
- YY1 associated protein 1 [Source:HGNC Symbol;Acc:30935]
- Mouse Orthologue:
- Gon4l
- Mouse Description:
- gon-4-like (C.elegans) Gene [Source:MGI Symbol;Acc:MGI:1917579]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa10568 | Essential Splice Site | Available for shipment | Available now |
sa23532 | Essential Splice Site | Available for shipment | Available now |
sa29218 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa10568
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079410 | Essential Splice Site | 135 | 712 | 5 | 20 |
ENSDART00000138322 | Essential Splice Site | 129 | 1033 | 4 | 25 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27174206)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27104318 GRCz11 19 26688541 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCATTYCCACTTGGAATATTTYACCAATTAAGAAGCCAACAGAAGCAAAG[G/A]TGATCAGCAGAGTACATTTGCAAGAAAACATGCATGAGACTGGGAGCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23532
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079410 | Essential Splice Site | 135 | 712 | 5 | 20 |
ENSDART00000138322 | Essential Splice Site | 129 | 1033 | 4 | 25 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27174207)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27104319 GRCz11 19 26688542 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATTCCCACTTGGAATATTTCACCAATTAAGAAGCCAACAGAAGCAAAGG[T/C]GATCAGCAGAGTACATTTGCAAGAAAACATGCATGAGACTGGGAGCAGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29218
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079410 | Nonsense | 676 | 712 | 20 | 20 |
ENSDART00000138322 | None | 1033 | None | 25 |
- Genomic Location (Zv9):
- Chromosome 19 (position 27188913)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 27119025 GRCz11 19 26703248 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATAAACACAACATACTGTTAAATAATTTCTCCTACATTTTTCAGACGTA[C/A]TTCATGGCAGGAAAATGCCCCTCCATGCCCTTGGCCAGTAAGAGGGTCAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: