svopa

Ensembl ID:
ENSDARG00000056833
ZFIN ID:
ZDB-GENE-060526-336
Description:
Novel protein similar to rat SV2 related protein [Source:UniProtKB/TrEMBL;Acc:A2BGT1]
Human Orthologue:
SVOP
Human Description:
SV2 related protein homolog (rat) [Source:HGNC Symbol;Acc:25417]
Mouse Orthologue:
Svop
Mouse Description:
SV2 related protein Gene [Source:MGI Symbol;Acc:MGI:1915916]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11273 Nonsense Available for shipment Available now
sa2230 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa11273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098727 Nonsense 366 549 12 16
ENSDART00000143205 Nonsense 355 538 11 15
Genomic Location (Zv9):
Chromosome 5 (position 21942872)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19655744
GRCz11 5 20159544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGCGAAGGGCAGTAAAATGGAGCCAGGTTGCAGTCTGGAGTGCAAATA[T/A]CTMAAYTCGGATGATTACAAGGATCTTCTGTGGACCACACTTTCTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2230
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098727 Nonsense 419 549 13 16
ENSDART00000143205 Nonsense 408 538 12 15
Genomic Location (Zv9):
Chromosome 5 (position 21943122)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 19655994
GRCz11 5 20159794
KASP Assay ID:
554-2915.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTGTGTTTCTTCGTCTTCTCCCTGTGCATTGTGCCACTCTACAGCTG[T/A]GTGGGAAGGTCAGAAATTACACATTAATTACTTTCATTTTAATAGGGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link