zgc:55521

Ensembl ID:
ENSDARG00000056832
ZFIN ID:
ZDB-GENE-040426-2828
Description:
Exonuclease 1 [Source:UniProtKB/Swiss-Prot;Acc:Q803U7]
Human Orthologue:
EXO1
Human Description:
exonuclease 1 [Source:HGNC Symbol;Acc:3511]
Mouse Orthologue:
Exo1
Mouse Description:
exonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:1349427]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17356 Essential Splice Site Available for shipment Available now
sa42919 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079390 Essential Splice Site 54 806 None 14
ENSDART00000140022 Essential Splice Site 54 163 None 5
ENSDART00000141523 Essential Splice Site 54 108 None 3

The following transcripts of ENSDARG00000056832 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 22402678)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22552827
GRCz11 17 22572663
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTTTTTCATGTGCAGAGAAGCTTGCAAAAGGGGAACCTACAGATCAG[T/G]GAGTTGTTTGCATGTANNNATGTTTATTTTTGATTGCAAYAAAATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079390 Essential Splice Site 501 806 10 14
ENSDART00000140022   None 163 None 5
ENSDART00000141523   None 108 None 3

The following transcripts of ENSDARG00000056832 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 22399830)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 22549979
GRCz11 17 22569815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAACCGATCAGAAGAGGGCACTGAAGAGCAGGGCACATGCAGCAG[G/A]TACTAGAGCATGATGGGAAGTATAACACAGCAATCACAAATTACTAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link