e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:55521
- Ensembl ID:
- ENSDARG00000056832
- ZFIN ID:
- ZDB-GENE-040426-2828
- Description:
- Exonuclease 1 [Source:UniProtKB/Swiss-Prot;Acc:Q803U7]
- Human Orthologue:
- EXO1
- Human Description:
- exonuclease 1 [Source:HGNC Symbol;Acc:3511]
- Mouse Orthologue:
- Exo1
- Mouse Description:
- exonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:1349427]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa17356 | Essential Splice Site | Available for shipment | Available now |
| sa42919 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa17356
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000079390 | Essential Splice Site | 54 | 806 | None | 14 |
| ENSDART00000140022 | Essential Splice Site | 54 | 163 | None | 5 |
| ENSDART00000141523 | Essential Splice Site | 54 | 108 | None | 3 |
The following transcripts of ENSDARG00000056832 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 17 (position 22402678)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 22552827 GRCz11 17 22572663 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGCTTTTTCATGTGCAGAGAAGCTTGCAAAAGGGGAACCTACAGATCAG[T/G]GAGTTGTTTGCATGTANNNATGTTTATTTTTGATTGCAAYAAAATCATGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42919
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000079390 | Essential Splice Site | 501 | 806 | 10 | 14 |
| ENSDART00000140022 | None | 163 | None | 5 | |
| ENSDART00000141523 | None | 108 | None | 3 |
The following transcripts of ENSDARG00000056832 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 17 (position 22399830)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 22549979 GRCz11 17 22569815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGAGGAACCGATCAGAAGAGGGCACTGAAGAGCAGGGCACATGCAGCAG[G/A]TACTAGAGCATGATGGGAAGTATAACACAGCAATCACAAATTACTAAAGC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Menopause (age at onset): Meta-analyses identify 13 loci associated with age at menopause and highlight DNA repair and immune pathways. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
