Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-163f12.7
- Ensembl ID:
- ENSDARG00000056774
- ZFIN ID:
- ZDB-GENE-081104-324
- Description:
- LOC567796 protein [Source:UniProtKB/TrEMBL;Acc:A7YY04]
- Human Orthologue:
- GPR37L1
- Human Description:
- G protein-coupled receptor 37 like 1 [Source:HGNC Symbol;Acc:14923]
- Mouse Orthologue:
- Gpr37l1
- Mouse Description:
- G protein-coupled receptor 37-like 1 Gene [Source:MGI Symbol;Acc:MGI:1928503]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa41182 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41182
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000067211 | Nonsense | 32 | 487 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 8 (position 21806161)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 21236058 GRCz11 8 21268143 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCTCTTCTGGCTCTAGCTTTGCTTCTGAGCGCATGTGCTTCAGAAGGG[A/T]AAAGAGGAAGGCCGAAAGGTCAAGAAAAGACACCTGTCGAGGAGGAGAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
