
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
crmp1
- Ensembl ID:
- ENSDARG00000056742
- ZFIN ID:
- ZDB-GENE-050720-1
- Description:
- collapsin response mediator protein 1 [Source:RefSeq peptide;Acc:NP_001018561]
- Human Orthologue:
- CRMP1
- Human Description:
- collapsin response mediator protein 1 [Source:HGNC Symbol;Acc:2365]
- Mouse Orthologue:
- Crmp1
- Mouse Description:
- collapsin response mediator protein 1 Gene [Source:MGI Symbol;Acc:MGI:107793]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19452 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31199 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19452
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064468 | None | 575 | None | 14 | |
ENSDART00000098095 | Nonsense | 17 | 674 | 1 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 13228251)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 13656993 GRCz11 1 14343506 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTCGGACTATAGGCGACAGTGGAACCGGGAGGATGAACTCCCGGTATA[T/A]CTGGCAAAGCCCATCTCGGCGGGCAACCAGCGGCAGAAGTCTCACGGAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31199
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000064468 | Essential Splice Site | 373 | 575 | 10 | 14 |
ENSDART00000098095 | Essential Splice Site | 472 | 674 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 13245589)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 13674331 GRCz11 1 14360844 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAACCAACGGAGTGGAGGAGAGAATGGGGTTTGTTTGGGATAAAGCTGTG[G/A]TAAGTGCATGTCTATGAATTGTGGCTACAGGTCGCATTCATTATTCATCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: