si:dkey-24f17.5

Ensembl ID:
ENSDARG00000056723
ZFIN ID:
ZDB-GENE-041210-354
Description:
hypothetical protein LOC100006131 [Source:RefSeq peptide;Acc:NP_001035472]
Human Orthologue:
FHAD1
Human Description:
forkhead-associated (FHA) phosphopeptide binding domain 1 [Source:HGNC Symbol;Acc:29408]
Mouse Orthologue:
Fhad1
Mouse Description:
forkhead-associated (FHA) phosphopeptide binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1920323]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21276 Essential Splice Site Available for shipment Available now
sa27183 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079263 Essential Splice Site 33 359 3 8
ENSDART00000125695 Essential Splice Site 33 227 3 6
ENSDART00000127545 Essential Splice Site 33 352 3 8
ENSDART00000133601 Essential Splice Site 33 221 3 6
Genomic Location (Zv9):
Chromosome 8 (position 21922597)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21352494
GRCz11 8 21384579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATCACTTGAGAGGACAGTCTTTAAGTGTTTGTCATCTCATGTACTC[A/T]GAACAGTGGGGTGGATGAATATCATGCCACTATTGACTGGTGTGAAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079263 Nonsense 296 359 7 8
ENSDART00000125695   None 227 None 6
ENSDART00000127545 Nonsense 289 352 7 8
ENSDART00000133601   None 221 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 21930516)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 21360413
GRCz11 8 21392498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGATCAGAAGATCAGCGCTTTATTAGAACAGATGGATAAACTCAGG[A/T]GACAAAATTCTTCCTCTACAGGTATGAGGATGCTATTAAGTGGATGACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link