Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:92127
- Ensembl ID:
- ENSDARG00000056720
- ZFIN ID:
- ZDB-GENE-040912-163
- Description:
- something about silencing protein 10 [Source:RefSeq peptide;Acc:NP_001004595]
- Human Orthologue:
- UTP3
- Human Description:
- UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:2447
- Mouse Orthologue:
- Utp3
- Mouse Description:
- UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa38845 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38845
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000079255 | Essential Splice Site | 234 | 470 | 9 | 16 |
The following transcripts of ENSDARG00000056720 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 11 (position 27307262)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 26136087 GRCz11 11 26373703 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTAATTCTGTTAATGCTATGCTAAATTAGAGTATTTACTGTATATTCA[G/A]CTTACAGAATTGAGGGATGAAGTTCAGCCACTTGTGAAGATGGTCAAGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
