zgc:92127

Ensembl ID:
ENSDARG00000056720
ZFIN ID:
ZDB-GENE-040912-163
Description:
something about silencing protein 10 [Source:RefSeq peptide;Acc:NP_001004595]
Human Orthologue:
UTP3
Human Description:
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:2447
Mouse Orthologue:
Utp3
Mouse Description:
UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38845 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079255 Essential Splice Site 234 470 9 16

The following transcripts of ENSDARG00000056720 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 27307262)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 26136087
GRCz11 11 26373703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAATTCTGTTAATGCTATGCTAAATTAGAGTATTTACTGTATATTCA[G/A]CTTACAGAATTGAGGGATGAAGTTCAGCCACTTGTGAAGATGGTCAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link