slc6a19b

Ensembl ID:
ENSDARG00000056719
ZFIN ID:
ZDB-GENE-030131-4755
Description:
sodium-dependent neutral amino acid transporter B(0)AT1 [Source:RefSeq peptide;Acc:NP_956030]
Human Orthologue:
SLC6A19
Human Description:
solute carrier family 6 (neutral amino acid transporter), member 19 [Source:HGNC Symbol;Acc:27960]
Mouse Orthologue:
Slc6a19
Mouse Description:
solute carrier family 6 (neurotransmitter transporter), member 19 Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22803 Nonsense Available for shipment Available now
sa15801 Nonsense Available for shipment Available now
sa22804 Essential Splice Site Available for shipment Available now
sa36095 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079248 Nonsense 42 651 1 12
Genomic Location (Zv9):
Chromosome 16 (position 20931828)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19168583
GRCz11 16 18974222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTGGAGGAGGCTGGAGACAGACCCAAGTGGGACAACAAAGCCCAATA[C/A]ATGCTGACCTGCGTGGGCTTCTGTGTGGGGTTGGGCAATGTCTGGCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079248 Nonsense 197 651 4 12
Genomic Location (Zv9):
Chromosome 16 (position 20942107)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19178862
GRCz11 16 18984501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTGAACACTTCAGCGGCTATAGATGATACGGGTGGTCTGCAGGTGTG[G/A]ATGGTCCTCTGTTTGAWCTCTGCATGGGCAGTGCTGTATGTCTGCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079248 Essential Splice Site 340 651 7 12
Genomic Location (Zv9):
Chromosome 16 (position 20947142)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19183897
GRCz11 16 18989536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATAATTGGTTTCAGAGCCACAGAGAGATTTGATGACTGTATGAATGGG[T/C]AAGTATTTAGCTGTGTCACAACACATCATTTGACCTTCTGTTTTGGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079248 Nonsense 417 651 9 12
Genomic Location (Zv9):
Chromosome 16 (position 20950139)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19186894
GRCz11 16 18992533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTGTGTTCACTGAGGCAATCACCAAGATGCCACTGTCTCCACTCTG[G/A]TCCGTCCTGTTCTTCATTATGCTCTTCTGCCTTGGCTTGTCCTCCATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link