vars2

Ensembl ID:
ENSDARG00000056717
ZFIN ID:
ZDB-GENE-060503-575
Description:
valyl-tRNA synthetase 2, mitochondrial (putative) [Source:RefSeq peptide;Acc:NP_001124133]
Human Orthologue:
VARS2
Human Description:
valyl-tRNA synthetase 2, mitochondrial (putative) [Source:HGNC Symbol;Acc:21642]
Mouse Orthologue:
Vars2
Mouse Description:
valyl-tRNA synthetase 2, mitochondrial (putative) Gene [Source:MGI Symbol;Acc:MGI:1916165]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23537 Nonsense Available for shipment Available now
sa15493 Nonsense Available for shipment Available now
sa36853 Nonsense Mutation detected in F1 DNA During 2018
sa43297 Nonsense Mutation detected in F1 DNA During 2018
sa36852 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079251 Nonsense 101 1057 4 30
Genomic Location (Zv9):
Chromosome 19 (position 27930405)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27860517
GRCz11 19 27444740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCCTTCCCACAATCCTACAGCCCAGAGTATGTGGATTTTGGCTGGTA[T/A]CAGTGGTGGGAGAAACAGGAATTCTTCAGTCCCGAGCAGCATGTAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079251 Nonsense 548 1057 18 30
Genomic Location (Zv9):
Chromosome 19 (position 27913827)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27843939
GRCz11 19 27428162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KTCATGAGCAGGAGCATTGGGTTYGGGGCAGAAGTGCTGCAGAGGCTCAA[C/T]AGCRTGCCASTATAAAGTTTGGAGTGAATCCTGAGGCCATCWCACTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079251 Nonsense 631 1057 20 30
Genomic Location (Zv9):
Chromosome 19 (position 27910105)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27840217
GRCz11 19 27424440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGATGGTGATGCTGGGCACAGAGTTGACAGGACAGCTGCCCTTTAAA[C/T]AGGTTGCGTTGGTGGCTTATTGCCCAGCTCATAACTCTAAATGCCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079251 Nonsense 924 1057 28 30
Genomic Location (Zv9):
Chromosome 19 (position 27887466)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27817578
GRCz11 19 27401801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAACTCTATATAGAAAGATTGTTTTCTCCACCATCTCTTCTAGTGTA[C/A]GCAGTGTGTGCTCCAGATCAGATGGAGATTCTCCTGTGCTTCAGATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079251 Nonsense 1016 1057 29 30
Genomic Location (Zv9):
Chromosome 19 (position 27887094)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27817206
GRCz11 19 27401429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCAGAGAAAAGCTGGCGTTCAAATTAAAACAAGCCCTCGCTCGCACA[C/T]AGACGCACAGCTACATCGAAAAAGTACCTCAGAAAGTCAGACAAGAGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link