abcb8

Ensembl ID:
ENSDARG00000056672
ZFIN ID:
ZDB-GENE-050410-6
Description:
ATP-binding cassette sub-family B member 8, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q56A55]
Human Orthologue:
ABCB8
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 8 [Source:HGNC Symbol;Acc:49]
Mouse Orthologue:
Abcb8
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1351667]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37928 Nonsense Available for shipment Available now
sa32493 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079202 Nonsense 206 714 4 16
Genomic Location (Zv9):
Chromosome 24 (position 35054880)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33906329
GRCz11 24 33792504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATATATAAAAGCTTTTTATATTTTTTATTTTCATCTTTCAGGGTCTGT[T/A]GACCAGTGGCTACATCATTCTTCTGTCTAGAGTTGGAGAAAGAGTGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079202 Essential Splice Site 325 714 7 16
Genomic Location (Zv9):
Chromosome 24 (position 35052312)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 33903761
GRCz11 24 33789936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACTTTTATTCCTATTTGTACGAAAAGTGTCTTTCTTTTTTCTCTTACA[G/A]GTTGCTAAAGCTACAGGAGTGGCCGATGAGGCTCTTGGTAACGTGCGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link