sp8b

Ensembl ID:
ENSDARG00000056666
ZFIN ID:
ZDB-GENE-030131-3654
Description:
Transcription factor Sp8 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0J3]
Human Orthologue:
SP8
Human Description:
Sp8 transcription factor [Source:HGNC Symbol;Acc:19196]
Mouse Orthologue:
Sp8
Mouse Description:
trans-acting transcription factor 8 Gene [Source:MGI Symbol;Acc:MGI:2443471]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22810 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079201 Nonsense 214 455 2 2
ENSDART00000112147 Nonsense 196 437 2 2
ENSDART00000112894 Nonsense 196 437 2 2
ENSDART00000139357 Nonsense 196 248 2 2
Genomic Location (Zv9):
Chromosome 16 (position 21494999)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 19731874
GRCz11 16 19537693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGGTGGGCTGCAAACTTCTTTACACTCTCCTCTGGGCGGATACAACT[C/A]AGACTACTCGAGTTTAAGCCACTCTGCCTTCAGTACCAGCGCGTCCCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link