zgc:171814

Ensembl ID:
ENSDARG00000056651
ZFIN ID:
ZDB-GENE-080402-10
Description:
hypothetical protein LOC100144564 [Source:RefSeq peptide;Acc:NP_001116530]
Human Orthologues:
AC144571.1, GFRA1, GFRA2, GFRA3
Human Descriptions:
GDNF family receptor alpha 1 [Source:HGNC Symbol;Acc:4243]
GDNF family receptor alpha 2 [Source:HGNC Symbol;Acc:4244]
GDNF family receptor alpha 3 [Source:HGNC Symbol;Acc:4245]
Mouse Orthologues:
Gfra1, Gfra2, Gfra3
Mouse Descriptions:
glial cell line derived neurotrophic factor family receptor alpha 1 Gene [Source:MGI Symbol;Acc:MGI:
glial cell line derived neurotrophic factor family receptor alpha 2 Gene [Source:MGI Symbol;Acc:MGI:
glial cell line derived neurotrophic factor family receptor alpha 3 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30969 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42161 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44783 Nonsense Mutation detected in F1 DNA During 2018
sa42160 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079176 Essential Splice Site 18 440 1 8
ENSDART00000141103   None 437 None 9
ENSDART00000079176 Essential Splice Site 18 440 1 8
ENSDART00000141103   None 437 None 9
Genomic Location (Zv9):
Chromosome 13 (position 14167085)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14175080
GRCz11 13 14306072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGACGTAAGGACAGCTGGAAACGCTGCAACGTGTTCATCAACGCTGG[T/C]AGGACAAAGACATTTTCTTCAGTAGCTATGAATTGTTTCCTGAAAACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079176 Essential Splice Site 18 440 1 8
ENSDART00000141103   None 437 None 9
ENSDART00000079176 Essential Splice Site 18 440 1 8
ENSDART00000141103   None 437 None 9
Genomic Location (Zv9):
Chromosome 13 (position 14167085)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14175080
GRCz11 13 14306072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGACGTAAGGACAGCTGGAAACGCTGCAACGTGTTCATCAACGCTGG[T/C]AGGACAAAGACATTTTCTTCAGTAGCTATGAATTGTTTCCTGAAAACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079176 Nonsense 71 440 2 8
ENSDART00000141103 Nonsense 68 437 2 9
Genomic Location (Zv9):
Chromosome 13 (position 14112181)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14120176
GRCz11 13 14251168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGGCGGAGGAAGCGTCAAGCTGGGTCCAGGAGCACGAAACCACTGC[G/T]AGAACGCCGTTACAGCCCTCATGTCCAGTCCCCTACACAGATGCCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079176 Essential Splice Site 137 440 3 8
ENSDART00000141103 Essential Splice Site 134 437 3 9
Genomic Location (Zv9):
Chromosome 13 (position 14111685)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 14119680
GRCz11 13 14250672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTTGAGCGGGGTTTTGATTATGTTCGCCTGGCCTCCATTGCTGCAG[G/A]TCAGTGATTTGCACAGACACACTATGCCGATTATGTGCTATGATGTTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link