zgc:113276

Ensembl ID:
ENSDARG00000056650
ZFIN ID:
ZDB-GENE-050522-7
Description:
hypothetical protein LOC553748 [Source:RefSeq peptide;Acc:NP_001018555]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12326 Nonsense Available for shipment Available now
sa41864 Nonsense Mutation detected in F1 DNA During 2018
sa45431 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079175 Nonsense 151 513 3 9

The following transcripts of ENSDARG00000056650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 30821899)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29697885
GRCz11 11 29945059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATTTCAGTCTTCCAGGAACACAGCTCAGTATTGACTWCTTCCRGGAG[C/T]AGGTCTGAGCCTCACTCRGCATGAGGAATTGAAAGGAATGCCYGACTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079175 Nonsense 355 513 6 9

The following transcripts of ENSDARG00000056650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 30819060)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29695046
GRCz11 11 29942220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATGATAAAACAAGCCAGGAAAGGAGGAGCAGTGACCCCTGAGGCCTA[T/A]GCACAACTTCAGCCTTTTATTCAGAGCGGAAAGCTGCTCATCAGAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079175 Essential Splice Site 428 513 7 9

The following transcripts of ENSDARG00000056650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 30818759)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29694745
GRCz11 11 29941919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTCAGGACCCTTTACTCTCTGATGTCAAGAGACAATTCCCCATTCAT[G/A]TGAGAAAGTGATAATGTATAAAGTTTGCATCATTCAATTTCATATAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link