ext2

Ensembl ID:
ENSDARG00000056648
ZFIN ID:
ZDB-GENE-041124-3
Description:
exostosin-2 [Source:RefSeq peptide;Acc:NP_001008400]
Human Orthologue:
EXT2
Human Description:
exostosin 2 [Source:HGNC Symbol;Acc:3513]
Mouse Orthologue:
Ext2
Mouse Description:
exostoses (multiple) 2 Gene [Source:MGI Symbol;Acc:MGI:108050]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38611 Nonsense Mutation detected in F1 DNA During 2018
sa34076 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079165 Nonsense 94 719 2 15

The following transcripts of ENSDARG00000056648 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 27973225)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26576164
GRCz11 7 26847357
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGGAGGGGTGACCTGAGCTGCCGGATGCACACCTGCTTTGATGTTTA[T/A]CGCTGTGGATATAATCCTAAGAACAAAATCAAGGTAATGCACAAACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079165 Essential Splice Site 674 719 15 15

The following transcripts of ENSDARG00000056648 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 28017519)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 26620458
GRCz11 7 26891651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGATTATCCACATTGCCCTATTCCTCAGCCTCTTTCTTTTTTCCTTCCA[G/A]GTCTGAGTGCATAAACAAGTTCGCCTCTGTGTTCGGCACCATGCCTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link