slc22a7b

Ensembl ID:
ENSDARG00000056643
ZFIN ID:
ZDB-GENE-040426-1311
Description:
solute carrier family 22, member 7-like [Source:RefSeq peptide;Acc:NP_956643]
Human Orthologue:
SLC22A7
Human Description:
solute carrier family 22 (organic anion transporter), member 7 [Source:HGNC Symbol;Acc:10971]
Mouse Orthologue:
Slc22a7
Mouse Description:
solute carrier family 22 (organic anion transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:18595

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32148 Essential Splice Site Available for shipment Available now
sa365 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031998 Essential Splice Site 214 546 4 10
ENSDART00000132520 Essential Splice Site None 232 5 11
Genomic Location (Zv9):
Chromosome 17 (position 21837279)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21987428
GRCz11 17 22007264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACTTATGTTGTGAGTTTATTTTAAAGAATACACATTATATTTCCTCA[G/A]GCATAGAATGGGCGGATATTGCACATAGGACGATTGCTGGTGTTATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031998 Nonsense 311 546 5 10
ENSDART00000132520   None 232 6 11
Genomic Location (Zv9):
Chromosome 17 (position 21836923)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21987072
GRCz11 17 22006908
KASP Assay ID:
554-0235.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTGCCTCGGTCAATAATAGACAACACAACCTCAGAGATATCAAACCA[G/T]AGGTAAATATTCAACATACAACACTAAGAAAAGGATGAGGTTTTCTGCGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

Control on top; Mutant below; 48 hpf

zoom

Control; 48 hpf

Control; 48 hpf

zoom

Mutant; 48 hpf

Mutant; 48 hpf

zoom

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
swim bladder
ZFA:0000076
aplastic
PATO:0001483
abnormal
PATO:0000460

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link