
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
hdac9b
- Ensembl ID:
- ENSDARG00000056642
- ZFIN ID:
- ZDB-GENE-040109-7
- Description:
- Histone deacetylase 9-B [Source:UniProtKB/Swiss-Prot;Acc:Q6PBI4]
- Human Orthologue:
- HDAC9
- Human Description:
- histone deacetylase 9 [Source:HGNC Symbol;Acc:14065]
- Mouse Orthologue:
- Hdac9
- Mouse Description:
- histone deacetylase 9 Gene [Source:MGI Symbol;Acc:MGI:1931221]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22811 | Missense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22811
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079155 | Missense | 243 | 643 | 6 | 13 |
ENSDART00000079159 | Missense | 212 | 612 | 4 | 11 |
ENSDART00000147161 | Missense | 209 | 267 | 4 | 6 |
The following transcripts of ENSDARG00000056642 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 16 (position 21963948)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 20070391 GRCz11 16 19876210 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTACATTGAATGGGATCCCTCAGAAAATCACGCAGAGCTCTAAACTCTGG[T/C]ACACGTAAGTTGTCTTCATGTGTACTGTTTAACTTACAGGATTAATTTAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Male-pattern baldness: Six novel susceptibility Loci for early-onset androgenetic alopecia and their unexpected association with common diseases. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Retinopathy in non-diabetics: Genome-wide association study of retinopathy in individuals without diabetes. (View Study)
- Stroke: Genome-wide association study identifies a variant in HDAC9 associated with large vessel ischemic stroke. (View Study)
- Stroke (ischemic): Genetic risk factors for ischaemic stroke and its subtypes (the METASTROKE collaboration): a meta-analysis of genome-wide association studies. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: