si:dkey-6e12.3

Ensembl ID:
ENSDARG00000056639
ZFIN ID:
ZDB-GENE-050419-197
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPL4]
Human Orthologue:
RLTPR
Human Description:
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing [Source:HGNC Symbol
Mouse Orthologue:
Rltpr
Mouse Description:
RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing Gene [Source:MGI Sy

Alleles

There are 19 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36650 Nonsense Available for shipment Available now
sa43107 Nonsense Mutation detected in F1 DNA During 2018
sa36651 Nonsense Mutation detected in F1 DNA During 2018
sa29036 Essential Splice Site Mutation detected in F1 DNA During 2018
sa6517 Nonsense Mutation detected in F1 DNA During 2018
sa43108 Nonsense Mutation detected in F1 DNA During 2018
sa23302 Essential Splice Site Available for shipment Available now
sa43109 Nonsense Mutation detected in F1 DNA During 2018
sa12493 Nonsense Available for shipment Available now
sa13235 Essential Splice Site Available for shipment Available now
sa23303 Essential Splice Site Available for shipment Available now
sa23304 Nonsense Available for shipment Available now
sa15203 Nonsense Available for shipment Available now
sa43110 Nonsense Mutation detected in F1 DNA During 2018
sa6518 Essential Splice Site Mutation detected in F1 DNA During 2018
sa23305 Nonsense Available for shipment Available now
sa29037 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32208 Essential Splice Site Available for shipment Available now
sa13566 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 12 1338 1 39
ENSDART00000141051   None 594 None 20
Genomic Location (Zv9):
Chromosome 18 (position 22083466)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22313689
GRCz11 18 22302755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGTGATCAACCATTATGGCGGCGCTGCCTGAGGTCCCGTTTTGCCTC[A/T]AAGGTAAGACTTTTATTTTAATCTCAGAATAAGCCACTGGAATATGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 19 1338 2 39
ENSDART00000141051   None 594 None 20
Genomic Location (Zv9):
Chromosome 18 (position 22083708)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22313931
GRCz11 18 22302997
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTTAAGTGGTTGTGTTTTTGAGTTGCAGAAGGTATAACCCAGTATT[T/A]GAAGCCACAAAGGGTTCAGTTTATGAGTTTGGTGCATCTCAACCAGGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 68 1338 4 39
ENSDART00000141051 Nonsense 7 594 1 20
Genomic Location (Zv9):
Chromosome 18 (position 22088303)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22318526
GRCz11 18 22307592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTACAGTGTTTGTGTCTCTCGCTGCAGGTGGAAAGCTCCTTCAGCTA[T/A]CTAGAGATCTATGCCATCACCATCGACAGCATTGAGCAGGTAAGAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site 228 1338 9 39
ENSDART00000141051 Essential Splice Site 167 594 6 20
Genomic Location (Zv9):
Chromosome 18 (position 22100405)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22330628
GRCz11 18 22319694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCTTCAATCAGTGGTTCACGAAAATATGCAGCAAGGACTTCAAACTGG[T/A]ATGTATGTCCATTCTAGAAAAATAAACTTATTGAATGTGTTATTAATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 358 1338 14 39
ENSDART00000141051 Nonsense 297 594 11 20
Genomic Location (Zv9):
Chromosome 18 (position 22104307)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22334530
GRCz11 18 22323596
KASP Assay ID:
554-4328.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAATRAGTGAAATCACATGTTGCCTGTTGTCTCTTTCAGAGCCTCTA[T/G]AGGTTCCTGTCTGCTCCAAATTCAGTTTCTCAYCTGGACCTCAGCTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 388 1338 15 39
ENSDART00000141051 Nonsense 327 594 12 20
Genomic Location (Zv9):
Chromosome 18 (position 22108691)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22338914
GRCz11 18 22327980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTTTTCTTTTCTTTTGGTTTCTTATTAGCTGTTTGTGTCTCTTTCTT[T/A]GGGCTGCTGCACTACTCTGAACTACCTCAATCTCTCCAGGAACCCGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site 407 1338 16 39
ENSDART00000141051 Essential Splice Site 346 594 13 20
Genomic Location (Zv9):
Chromosome 18 (position 22108830)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22339053
GRCz11 18 22328119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTCTCTGCACAGACAGCATGTTTACACTGATCTGTTTGGCTCTGCT[A/G]GGAAAGTACGAGAGGTCACGCGCAGTGTGAGGGATTTCTTTAGCAAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 410 1338 16 39
ENSDART00000141051 Nonsense 349 594 13 20
Genomic Location (Zv9):
Chromosome 18 (position 22108839)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22339062
GRCz11 18 22328128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACAGACAGCATGTTTACACTGATCTGTTTGGCTCTGCTAGGAAAGTA[C/T]GAGAGGTCACGCGCAGTGTGAGGGATTTCTTTAGCAAGAGCACTGTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12493
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 536 1338 20 39
ENSDART00000141051 Nonsense 475 594 17 20
Genomic Location (Zv9):
Chromosome 18 (position 22117470)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22347693
GRCz11 18 22336759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGYATTCTTATTTTCAGGGCTCTAACAGATGTGTTGCACCGACTCGTA[C/T]AACTAATTCAAGAGGAGGAGTGTGTGAGTACATTATTTGTAATAAWACRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site 601 1338 21 39
ENSDART00000141051 Essential Splice Site 540 594 18 20
Genomic Location (Zv9):
Chromosome 18 (position 22122084)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22352307
GRCz11 18 22341373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGAGCAAAGATGCTGGCAAAGGCCCTCATGATGAACACCAAGCTAAA[G/T]TAATTTGCCACTCACAGYGATTTRCAGCTTGWTTGACAGGTTTCTGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site 601 1338 21 39
ENSDART00000141051 Essential Splice Site 540 594 18 20
Genomic Location (Zv9):
Chromosome 18 (position 22122085)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22352308
GRCz11 18 22341374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGCAAAGATGCTGGCAAAGGCCCTCATGATGAACACCAAGCTAAAG[T/A]AATTTGCCACTCACAGTGATTTACAGCTTGTTTGACAGGTTTCTGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 622 1338 22 39
ENSDART00000141051 Nonsense 561 594 19 20
Genomic Location (Zv9):
Chromosome 18 (position 22122330)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22352553
GRCz11 18 22341619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCGGAACAATGTGACTGCTGGAGGATTTATGGATGTGGCCAATGCCT[T/A]GGAAAAGTCAGAGTAACTCATAAAAGCCTACAGGCTATTGGTTTTCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 675 1338 24 39
ENSDART00000141051   None 594 None 20
Genomic Location (Zv9):
Chromosome 18 (position 22122667)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22352890
GRCz11 18 22341956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTACGCAGGAACAATCAGAGGCAGTGTGGAATGACTGAGGAAATGTG[T/A]CATTTACAACATGGACTAAAGACCACTYGCTCTGAGCAGGTTTGTYAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43110
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 899 1338 30 39
ENSDART00000141051   None 594 None 20
Genomic Location (Zv9):
Chromosome 18 (position 22130311)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22360534
GRCz11 18 22349600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCATGTCCACAGTACGTCCCGGTCATCTGGAGGAACAGCTTCCACT[C/A]GCGCAGCATCCGTCCTGCCCCTTCCATCAAAAGTAAGTCCCTTGAGTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site 910 1338 30 39
ENSDART00000141051   None 594 None 20
Genomic Location (Zv9):
Chromosome 18 (position 22130345)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22360568
GRCz11 18 22349634
KASP Assay ID:
554-5100.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAACAGCTTCCACTCGCGCAGCATCCGTCCTGCCCCTTCCATCAAAAG[T/C]AAGTCCCTTGAGTCCTGATGCCGACAAGTGCTTCTTGCTCAAATCTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Nonsense 1052 1338 32 39
ENSDART00000141051   None 594 None 20

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22157305)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22387528
GRCz11 18 22376594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGACCTTGTATTCGTTTGTGTCTGTAAAGGAGCAGGCCGCAGAGATC[G/T]AGAATGAGGCCAATGAGAACATGGGGAGGGTTGATGAAGGTGTAGAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site None 1338 35 39
ENSDART00000141051   None 594 None 20

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22199084)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22429307
GRCz11 18 22418373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATATCCCTAGACCCAAAGCAGAAGTTCCAAGTGCAAGCTCTCAGAAG[G/A]TAAAGTATCAGCTCAAGAATACAAACACAAATAAAAGAGGTTTTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site None 1338 None 39
ENSDART00000141051   None 594 None 20

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22201336)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22431559
GRCz11 18 22420625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAATCACAATTACTAAGGTGTTCGATTTTGCTGGAGAAGAGGTTCGG[T/C]AAGTACAAGTCGTTTGTGTGGCCACTAGATGGCAGCATCTAATCATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050311 Essential Splice Site None 1338 None 39
ENSDART00000141051   None 594 None 20

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22251713)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22481936
GRCz11 18 22471002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGGGCATCACAGATGAGCTGGCAATCCATAATMGAGGCAAAGAAGGG[T/A]AWGTTTAAGCCTCATTAGTGACCCAGACAAACACATCATCTCGTATTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link