si:rp71-1p14.10

Ensembl ID:
ENSDARG00000056619
ZFIN ID:
ZDB-GENE-030131-8077
Description:
Rho GTPase-activating protein 42 [Source:UniProtKB/Swiss-Prot;Acc:Q6ZM89]
Human Orthologue:
ARHGAP42
Human Description:
Rho GTPase activating protein 42 [Source:HGNC Symbol;Acc:26545]
Mouse Orthologue:
Arhgap42
Mouse Description:
Rho GTPase activating protein 42 Gene [Source:MGI Symbol;Acc:MGI:1918794]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23928 Essential Splice Site Available for shipment Available now
sa8901 Nonsense Mutation detected in F1 DNA During 2018
sa8645 Nonsense Mutation detected in F1 DNA During 2018
sa29585 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29586 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 128 805 4 21
Genomic Location (Zv9):
Chromosome 21 (position 21877494)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22725907
GRCz11 21 22762512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCACACCGCTGGAGAAGTTTCGCAAAGAGCAGATCGGAGCGGCCAAAG[T/C]AAGTTCTTAGAGGCCCATTGTGAGTTAATGTTGTACGTGTCAGCGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Nonsense 166 805 6 21
Genomic Location (Zv9):
Chromosome 21 (position 21884511)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22732924
GRCz11 21 22769529
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACYCAGAGTATAACACTGTTTTTGAATGATTTTGTAGGCAGACACA[C/T]AGATCAGKAAGGAGAGACAGGTCTTCTATGAYGCCTCTCTCGAATAWGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Nonsense 181 805 6 21
Genomic Location (Zv9):
Chromosome 21 (position 21884558)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22732971
GRCz11 21 22769576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAYAGATCAGKAAGGAGAGACAGGTCTTCTATGAYGCCTCTCTCGAATA[T/A]GTTTTCAAAATCCAAGAAGTACAAGAGAGGAAAAAGTTTGAGTTTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 199 805 6 21
Genomic Location (Zv9):
Chromosome 21 (position 21884613)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22733026
GRCz11 21 22769631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAATCCAAGAAGTACAAGAGAGGAAAAAGTTTGAGTTTGTTGAGCCG[G/A]TAAGATGCGCTTATTTATGATGAAATCAGATATACAATGAAAGCTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079145 Essential Splice Site 277 805 8 21
Genomic Location (Zv9):
Chromosome 21 (position 21887328)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22735741
GRCz11 21 22772346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCCGGGACAGTGGACGATGGAGGGCTTTCTCTATGTACAGGAGAAAC[G/A]TGAGTGACTTCCTGTGTCAGAGCATCTATAAATAGTCTGTGTGTTTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link