xk

Ensembl ID:
ENSDARG00000056618
ZFIN ID:
ZDB-GENE-080908-1
Description:
membrane transport protein XK [Source:RefSeq peptide;Acc:NP_001012254]
Human Orthologue:
XK
Human Description:
X-linked Kx blood group (McLeod syndrome) [Source:HGNC Symbol;Acc:12811]
Mouse Orthologue:
Xk
Mouse Description:
Kell blood group precursor (McLeod phenotype) homolog Gene [Source:MGI Symbol;Acc:MGI:103569]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35109 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079149 Nonsense 242 437 3 3
Genomic Location (Zv9):
Chromosome 11 (position 30696112)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29572098
GRCz11 11 29819272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGTCCTCTTCAGCTCCGTGCTGAAGGTATGGGTGTTTCCGGTGGTGT[T/A]GGCCAACTTCATCCTCTTCTTTCTTCACCCGTGGGCCCTTTTCTGGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link