
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
plekha3
- Ensembl ID:
- ENSDARG00000056601
- ZFIN ID:
- ZDB-GENE-040426-1252
- Description:
- pleckstrin homology domain-containing family A member 3 [Source:RefSeq peptide;Acc:NP_957501]
- Human Orthologues:
- AC005795.1, PLEKHA3
- Human Descriptions:
- pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3 [Source
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J6N1]
- Mouse Orthologue:
- Plekha3
- Mouse Description:
- pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3 Gene [S
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13861 | Nonsense | Available for shipment | Available now |
sa35108 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa13861
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079117 | Nonsense | 33 | 298 | 2 | 8 |
The following transcripts of ENSDARG00000056601 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 11 (position 30641450)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 29517436 GRCz11 11 29764610 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCCAAGGTGGTTTGTGCTGGACAATGGCATTATTTCCTATTATGAYTCA[C/T]AAGATGACGTGTGCAAAGGAAGCAAAGGCAGTATTAAGATGTCAGTGTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35108
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079117 | Nonsense | 173 | 298 | 5 | 8 |
The following transcripts of ENSDARG00000056601 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 11 (position 30638902)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 29514888 GRCz11 11 29762062 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCATTACTAAGTGCCACCTGTGAAACCTTCATCAAAACACTGGAAGAATG[T/A]ATGAAGATCGCCAACTCTAAGTTCAAGACTGACATGTTGCAGTCCAGTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: