zgc:55344

Ensembl ID:
ENSDARG00000056559
ZFIN ID:
ZDB-GENE-040426-698
Description:
Vacuolar fusion protein CCZ1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q803R2]
Human Orthologues:
C7orf28B, CCZ1
Human Descriptions:
CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae) [Source:HGNC Sym
chromosome 7 open reading frame 28B [Source:HGNC Symbol;Acc:21717]
Mouse Orthologue:
AU022870
Mouse Description:
expressed sequence AU022870 Gene [Source:MGI Symbol;Acc:MGI:2141070]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10116 Nonsense Available for shipment Available now
sa10130 Nonsense Available for shipment Available now
sa35251 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa10116
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079065 Nonsense 337 480 14 17
ENSDART00000079065 Nonsense 337 480 14 17
Genomic Location (Zv9):
Chromosome 12 (position 18735810)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17546387
GRCz11 12 17668261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTTCTCTCTGTGTTAATAGCCTCGGTGGATTTGAATCGGGAGTTTTG[T/A]GAGAAATTAGACAGCTTGGTTGGACCCCAACTCACCCTGYTGGCCTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10130
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079065 Nonsense 337 480 14 17
ENSDART00000079065 Nonsense 337 480 14 17
Genomic Location (Zv9):
Chromosome 12 (position 18735810)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17546387
GRCz11 12 17668261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTTCTCTCTGTGTTAATAGCCTCGGTGGATTTGAATCGGGAGTTTTG[T/A]GAGAAATTAGACAGCTTGGTTGGACCCCAACTCACCCTGYTGGCCTCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079065 Nonsense 386 480 15 17
Genomic Location (Zv9):
Chromosome 12 (position 18730990)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 17541567
GRCz11 12 17663441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGGAGCCTCAGTTTAAATTCATCTACTTCAACCACATGAACTTGGCT[G/T]AGAAAAGCACCATCCACATGCGCAAGACGGCCAGTGTTTCCCTCACCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link