zgc:175180

Ensembl ID:
ENSDARG00000056554
ZFIN ID:
ZDB-GENE-080402-9
Description:
rap1 GTPase-activating protein 1 [Source:RefSeq peptide;Acc:NP_001116525]
Human Orthologue:
RAP1GAP
Human Description:
RAP1 GTPase activating protein [Source:HGNC Symbol;Acc:9858]
Mouse Orthologue:
Rap1gap
Mouse Description:
Rap1 GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:109338]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45003 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39406 Nonsense Mutation detected in F1 DNA During 2018
sa37693 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079035 Essential Splice Site 13 695 4 25
ENSDART00000130375 Essential Splice Site 13 695 1 22
ENSDART00000147696 Essential Splice Site 22 704 4 25

The following transcripts of ENSDARG00000056554 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22670607)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22449914
GRCz11 23 22376465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCAACAGAATGGACGAGCAGCGATGCACTTTTCCTCCTCCTCTCAAA[G/A]TAGGTTCACCTCATGGCTCCCTTTTGTCCCTTTACACTCACAAAAATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079035 Nonsense 109 695 7 25
ENSDART00000130375 Nonsense 109 695 4 22
ENSDART00000147696 Nonsense 118 704 7 25

The following transcripts of ENSDARG00000056554 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22675514)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22454821
GRCz11 23 22381372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTATACAGTGGACAGTGCCCTCGGCCACCTGGTGTTCTCCATGAAATA[T/G]GATGTTATTGGGGACCAAGAGCATCTCCGGCTCATGCTCAGGTGTGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079035 Essential Splice Site 196 695 11 25
ENSDART00000130375 Essential Splice Site 196 695 8 22
ENSDART00000147696 Essential Splice Site 205 704 11 25

The following transcripts of ENSDARG00000056554 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 22682877)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 22462184
GRCz11 23 22388735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTAGCTTGAAACTTATCAACATTTTATGTGTGTTTATGTGTGTA[G/A]ACCTCAGAGGAGGAGCTGTTTGGGAATAACGAGGAGGGTCCTGCTTTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link