zgc:100952

Ensembl ID:
ENSDARG00000056550
ZFIN ID:
ZDB-GENE-040808-42
Description:
hypothetical protein LOC445324 [Source:RefSeq peptide;Acc:NP_001003781]
Human Orthologue:
C22orf25
Human Description:
chromosome 22 open reading frame 25 [Source:HGNC Symbol;Acc:25439]
Mouse Orthologue:
D16H22S680E
Mouse Description:
DNA segment, Chr 16, human D22S680E, expressed Gene [Source:MGI Symbol;Acc:MGI:101825]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40432 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079064 Essential Splice Site 89 273 4 9
Genomic Location (Zv9):
Chromosome 5 (position 28345230)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 26100528
GRCz11 5 26700681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACCAATTACCTGGAAGCACGGCAAAATCCAGACGCCCAGGGGAGAGG[T/C]AGCACAGCTCTTTCAGCCATTTGTATTAATGCACTCTGCTATTACCGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link