
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
nr0b1
- Ensembl ID:
- ENSDARG00000056541
- ZFIN ID:
- ZDB-GENE-070130-1
- Description:
- nuclear receptor subfamily 0 group B member 1 [Source:RefSeq peptide;Acc:NP_001076416]
- Human Orthologue:
- NR0B1
- Human Description:
- nuclear receptor subfamily 0, group B, member 1 [Source:HGNC Symbol;Acc:7960]
- Mouse Orthologue:
- Nr0b1
- Mouse Description:
- nuclear receptor subfamily 0, group B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1352460]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41861 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa30950 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41861
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079060 | Nonsense | 263 | 264 | 2 | 2 |
ENSDART00000128468 | Nonsense | 291 | 292 | 2 | 2 |
ENSDART00000079060 | Nonsense | 263 | 264 | 2 | 2 |
ENSDART00000128468 | Nonsense | 291 | 292 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 30560307)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 29436293 GRCz11 11 29683467 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGTCATTGGCGCGGTCAACATGGAGGAACTTCTTCTGGAGATGTTTTAT[G/T]GAAAATAAACTTTGAAAAAAACTGGGAGAGAATTATCAGACTTGGAAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30950
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079060 | Nonsense | 263 | 264 | 2 | 2 |
ENSDART00000128468 | Nonsense | 291 | 292 | 2 | 2 |
ENSDART00000079060 | Nonsense | 263 | 264 | 2 | 2 |
ENSDART00000128468 | Nonsense | 291 | 292 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 11 (position 30560307)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 29436293 GRCz11 11 29683467 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGTCATTGGCGCGGTCAACATGGAGGAACTTCTTCTGGAGATGTTTTAT[G/T]GAAAATAAACTTTGAAAAAAACTGGGAGAGAATTATCAGACTTGGAAAGA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: