si:dkey-94n12.1

Ensembl ID:
ENSDARG00000056530
ZFIN ID:
ZDB-GENE-050208-428
Description:
hypothetical protein LOC100151400 [Source:RefSeq peptide;Acc:NP_001121890]
Human Orthologue:
CPAMD8
Human Description:
C3 and PZP-like, alpha-2-macroglobulin domain containing 8 [Source:HGNC Symbol;Acc:23228]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37504 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43829 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43830 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079046 Essential Splice Site 195 1749 None 39
ENSDART00000134893   None 734 None 18

The following transcripts of ENSDARG00000056530 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21582140)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21235388
GRCz11 22 21260366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCAAGGCCACACGTACAACAAATCGTTTGAAGTGCAGAAGTACGG[T/G]AAGCATTTATGTATTAATATATACTGTAAAATGTAAATAGAAGTAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079046 Essential Splice Site 661 1749 None 39
ENSDART00000134893   None 734 None 18

The following transcripts of ENSDARG00000056530 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21586645)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21239893
GRCz11 22 21264871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCATGGCACTGGGACATCACTAAAGATGCCCGTTTTGCTTTTACGG[T/A]GAGGACATGACTTTCTCCACTTCCCCGTATTGTTTTAAGCTCAGGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079046 Nonsense 705 1749 17 39
ENSDART00000134893   None 734 None 18

The following transcripts of ENSDARG00000056530 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21587647)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21240895
GRCz11 22 21265873
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGCGTTTCAACCACACACCTCTACCCTGGTGGCAGCTATGCACTCC[C/T]GATCTGGGACACGGTACACATGCTCACAGTGTCTGAAATTTTAAGGTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link