zgc:175192

Ensembl ID:
ENSDARG00000056525
ZFIN ID:
ZDB-GENE-030131-2774
Description:
breast cancer anti-estrogen resistance 1 [Source:RefSeq peptide;Acc:NP_001128605]
Human Orthologue:
BCAR1
Human Description:
breast cancer anti-estrogen resistance 1 [Source:HGNC Symbol;Acc:971]
Mouse Orthologue:
Bcar1
Mouse Description:
breast cancer anti-estrogen resistance 1 Gene [Source:MGI Symbol;Acc:MGI:108091]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36652 Nonsense Mutation detected in F1 DNA During 2018
sa11775 Nonsense Available for shipment Available now
sa9019 Nonsense Mutation detected in F1 DNA During 2018
sa39201 Essential Splice Site Mutation detected in F1 DNA During 2018
sa391 Nonsense Available for shipment Available now
sa1865 Nonsense F2 line generated During 2018
sa11159 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Nonsense 70 919 2 7
ENSDART00000126899 Nonsense 70 919 2 7
ENSDART00000128965 Nonsense 70 919 2 7
Genomic Location (Zv9):
Chromosome 18 (position 22411516)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22641739
GRCz11 18 22630805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATTGTTCCTGGCAACCGGCTGAAGATTCTCGTTGGCATGTATGATAAG[C/T]AGCAACAGCAGCAGCTACAGCAGTTAGCGAACCAACCCAGCCCAACCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Nonsense 72 919 2 7
ENSDART00000126899 Nonsense 72 919 2 7
ENSDART00000128965 Nonsense 72 919 2 7
Genomic Location (Zv9):
Chromosome 18 (position 22411522)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22641745
GRCz11 18 22630811
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGGCAACCGGCTGAARATTCTCGTTGGCAWGTATGATAAGCAGCAA[C/T]AGCAGCAGCTACAGCAGTTAGCGAACCAAMCCAGCCCAACCCAGAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Nonsense 276 919 3 7
ENSDART00000126899 Nonsense 276 919 3 7
ENSDART00000128965 Nonsense 276 919 3 7
Genomic Location (Zv9):
Chromosome 18 (position 22450513)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22680736
GRCz11 18 22669802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCGAGAYACCTTCCACCCAGCCAGGACATCTATGACGTGCCACCCACC[C/T]GAACCCAGTACATCCAAMAGGTAAAGAGTTCAGCAGAAAGAGCGACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Essential Splice Site 317 919 4 7
ENSDART00000126899 Essential Splice Site 317 919 4 7
ENSDART00000128965 Essential Splice Site 317 919 4 7
Genomic Location (Zv9):
Chromosome 18 (position 22458093)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22688316
GRCz11 18 22677382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACACTCCACCTAGTGTGGATAAGAGCCAGCTGCACTACCAACAAACGG[T/C]ACCCATCCATCTTTTTCATATTTATCTTATTTGCATATTTGATCTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa391
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Nonsense 319 919 5 7
ENSDART00000126899 Nonsense 319 919 5 7
ENSDART00000128965 Nonsense 319 919 5 7
Genomic Location (Zv9):
Chromosome 18 (position 22459837)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22690060
GRCz11 18 22679126
KASP Assay ID:
554-0253.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATAGGAGGCTTGTTTTGGTAAACACATTATTTCTTTTTACAGGTATA[T/A]GACATTCCTCCATCTGTCAGCAAAGACGTTCCAGATGGTCCAATCAGGGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa1865
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Nonsense 502 919 5 7
ENSDART00000126899 Nonsense 502 919 5 7
ENSDART00000128965 Nonsense 502 919 5 7
Genomic Location (Zv9):
Chromosome 18 (position 22460384)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22690607
GRCz11 18 22679673
KASP Assay ID:
554-1856.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTCCTGGATCTGGACCAGGCTATGGAGCGKCTGTCCCGTCATCAA[C/T]AGGCTGTGGARAGCTCYGTTTCWCTCCTCATGTCGTTCATCAGTGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058772 Essential Splice Site 750 919 7 7
ENSDART00000126899 Essential Splice Site 750 919 7 7
ENSDART00000128965 Essential Splice Site 750 919 7 7
Genomic Location (Zv9):
Chromosome 18 (position 22465905)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22696128
GRCz11 18 22685194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAATACATKTATSAAATWTTACTCACTMGTGTCTCTAATCTTTAACA[G/A]CTGAAGCAGTTTGAACGACTAGAGCAGGAGGTCTCTMGACCAATCAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link